Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV_Actb MMEJ donor
(Plasmid #97315)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97315 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Actb MMEJ donor
  • Alt name
    Actb MMEJ template
  • Species
    Synthetic
  • Insert Size (bp)
    879

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer M13R
  • 3′ sequencing primer M13F
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA sequence: agtccgcctagaagcacttg

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_Actb MMEJ donor was a gift from Hui Yang (Addgene plasmid # 97315 ; http://n2t.net/addgene:97315 ; RRID:Addgene_97315)
  • For your References section:

    Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, Shen X, Wei Y, Huang Z, Ying W, Wang Y, Nie YH, Zhang CC, Li S, Cheng L, Wang Q, Wu Y, Huang P, Sun Q, Shi L, Yang H. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. 10.1038/cr.2017.76 PubMed 28524166