Skip to main content
Addgene

Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
(Plasmid #97312)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97312 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lenti virus
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Actb HMEJ donor
  • Alt name
    Actb HMEJ template
  • gRNA/shRNA sequence
    agtccgcctagaagcacttg
  • Species
    Synthetic
  • Insert Size (bp)
    2431
  • Promoter U6, EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA was a gift from Hui Yang (Addgene plasmid # 97312 ; http://n2t.net/addgene:97312 ; RRID:Addgene_97312)
  • For your References section:

    Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, Shen X, Wei Y, Huang Z, Ying W, Wang Y, Nie YH, Zhang CC, Li S, Cheng L, Wang Q, Wu Y, Huang P, Sun Q, Shi L, Yang H. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. 10.1038/cr.2017.76 PubMed 28524166