K84M kinase-dead Nuak1-3xflag
(Plasmid
#97219)
-
PurposePlasmid expressing kinase-dead mutant Nuak1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbone3xflag-CMV plasmid
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 6299
- Total vector size (bp) 8299
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNuak1
-
Alt nameARK5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
MutationKinase-dead K84M
-
Entrez GeneNUAK1 (a.k.a. ARK5)
- Promoter T7
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTGGAAAATATACTGCTCGA
- 3′ sequencing primer GGTCAGGATGCAGTGCCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttp://dharmacon.gelifesciences.com/cdnas-and-orfs/mammalian-orfs/orfeome-collaboration/orfeome-collaboration-clones/?productId=B197C4CE-93C2-421F-AB6C-FB92D52CB839&sourceId=entrezgene/9891&term=BC160165 Modified with a kinase-dead K84M mutation
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K84M kinase-dead Nuak1-3xflag was a gift from Huda Zoghbi (Addgene plasmid # 97219 ; http://n2t.net/addgene:97219 ; RRID:Addgene_97219) -
For your References section:
Reduction of Nuak1 Decreases Tau and Reverses Phenotypes in a Tauopathy Mouse Model. Lasagna-Reeves CA, de Haro M, Hao S, Park J, Rousseaux MW, Al-Ramahi I, Jafar-Nejad P, Vilanova-Velez L, See L, De Maio A, Nitschke L, Wu Z, Troncoso JC, Westbrook TF, Tang J, Botas J, Zoghbi HY. Neuron. 2016 Oct 19;92(2):407-418. doi: 10.1016/j.neuron.2016.09.022. Epub 2016 Oct 6. 10.1016/j.neuron.2016.09.022 PubMed 27720485