Human CRISPR Inhibition Pooled Library (Dolcetto)
(Pooled Libraries #1000000114, #92385, #92385-LV, #92386, #92386-LV)

• Purpose:

  This human CRISPR inhibition library (Dolcetto) is in backbone pXPR_050. This Dolcetto library inhibits over 18,000 human genes and is used for genome-wide inhibition screening.

  Each gene inhibited by this library is targeted by 3–6 gRNAs. These gRNAs are split among the two pools: Set A (Cat# 92385) contains gRNAs 1–3, Set B (Cat# 92386) contains gRNAs 4–6. Each pool has a unique set of gRNAs, but both pools are designed to target the same genes. The slight discrepancy in number of genes targeted between Set A and Set B is because not all genes had six gRNAs.

  Depositor comments: Primers for the lentiGuide backbone can be used with this library in the Sequencing Protocol.

• Vector Backbone:

  pXPR_050 (Plasmid #96925) - does not express dCas9

• Depositing Labs: David Root, John Doench
• Publication: Sanson et al. Nat Commun. 2018 Dec 21;9(1):5416. doi: 10.1038/s41467-018-07901-8.

Library Details

• Species: Human
• Genes targeted: 18,901 (Set A), 18,899 (Set B)
• gRNAs: 57,050 (Set A), 57,011 (Set B)
• Controls: 500 unique non-targeting controls are in each of the two half-libraries (Set A and Set B)
• Lentiviral Generation: 3rd

Library Shipping

Each library is delivered in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

Pooled libraries #92385 and #92386 will be delivered as a single tube containing a pooled half-library with 3 gRNAs per gene.

Pooled library #1000000114 will be delivered as two tubes, each containing a pooled half-library with 3 gRNAs per gene (for a total of up to 6 unique gRNAs per gene).

• Volume: ∼20 µL
• Concentration: 50 ng/µL

Resource Information

• Protocols:
  • Library Amplification Protocol (PDF, 90 KB)
  • Sequencing Protocol (PDF, 162 KB)
• Depositor Data:
  • Human Dolcetto Set A Target Genes (TXT, 1.9 MB)
  • Human Dolcetto Set B Target Genes (TXT, 1.9 MB)
  • Human Dolcetto Set A sgRNA Abundance Graph (PDF, 18 KB)
  • Human Dolcetto Set B sgRNA Abundance Graph (PDF, 18 KB)

Terms and Licenses

Academic/Nonprofit Terms:

• UBMTA

Industry Terms:

• Not Available to Industry

Trademarks:

• Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/356626 for bioRxiv preprint.

Information for Lentiviral Prep (Catalog # 92385-LV, Set A)

Purpose

Ready-to-use lentiviral pooled library for CRISPR inhibition screening in human cells. Contains 57,050 sgRNAs, targeting 18,901 genes. Lentiviral particles carrying set A of the Dolcetto human CRISPR sgRNA inhibition library in backbone pXPR_050.

Delivery

• Volume: varies depending on titer
• Titer: ≥ 5 x 10⁶ TU/mL
• Storage: Store at -80 ℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO SFM
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 92385-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting the U6 and EF1alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward Primer: hU6-F, GAGGGCCTATTTCCCATGATT
  • Reverse Primer: EF1a-R, CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

This pooled library is shipped on dry ice as multiple aliquots, for a total of at least 1.15 x 10⁸ transducing units. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016).

A brief and partial description of how to use this virus:

1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 x 10⁶ suspension (or 3 x 10⁶ adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

2. The Dolcetto CRISPR inhibition pooled library (set A) has 57,050 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3 x 10⁷ infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5 x 10⁷ cells to ultimately achieve 2.3 x 10⁷ infected cells.

3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 x 10⁶ suspension (or 3 x 10⁶ adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

Information for Lentiviral Prep (Catalog # 92386-LV, Set B)

Purpose

Ready-to-use lentiviral pooled library for CRISPR inhibition screening in human cells. Contains 57,011 sgRNAs, targeting 18,899 genes. Lentiviral particles carrying set B of the Dolcetto human CRISPR sgRNA inhibition library in backbone pXPR_050.

Delivery

• Volume: varies depending on titer
• Titer: ≥ 5x10⁶ TU/mL
• Pricing: $2900 USD for viral preparation + $175 USD for pooled library DNA.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (10µL at 50ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO SFM
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 92386-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting the U6 and EF1alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward Primer: hU6-F, GAGGGCCTATTTCCCATGATT
  • Reverse Primer: EF1a-R, CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

This pooled library is shipped on dry ice as multiple aliquots, for a total of at least 1.15×10⁸ transducing units. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016).

A brief and partial description of how to use this virus:

1. Start by optimizing the infection conditions in your cell line in order to achieve 30-50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30-50% infection efficiency, and note the infection efficiency for this condition.

2. The Dolcetto CRISPR inhibition pooled library (set B) has 57,011 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3×10⁷ infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5×10⁷ cells to ultimately achieve 2.3×10⁷ infected cells.

3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

4. Based on a screening MOI of 0.5-1 and the total number of cells infected, Addgene estimates that 3-10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.