pGF1-4eCOL2A1
(Plasmid #97210)

• Purpose: Lentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoter
• Depositing Lab: Ryan Porter
• Publication: De La Vega et al Tissue Eng Part C Methods. 2019 Feb 6. doi: 10.1089/ten.TEC.2018.0295.

Backbone

• Vector backbone: pGreenFire1-mCMV (pTRH1 mCMV dscGFP T2A Fluc)
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 8540
• Total vector size (bp): 8808
• Modifications to backbone: Removal of mCMV sequence (139 bp) between SpeI and BamHI sites during subcloning of COL2A1 regulatory elements
• Vector type: Mammalian Expression, Lentiviral, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37)
• Alt name: COL2A1
• Species: H. sapiens (human)
• Insert Size (bp): 407
• Entrez Gene: COL2A1 (a.k.a. ANFH, AOM, COL11A3, SEDC, STL1)
• Promoter: COL2A1 regulatory elements

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGTGAACGGATCTCGACGGTATC
• 3′ sequencing primer: CTTCATCTTGTTGGTCATGCGGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert synthesized by GenScript prior to subcloning into pGreenFire1-mCMV
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct can be used for reporting chondrogenic differentiation by transduced stem/progenitor cells.

An NheI site has been placed in between the 4 x enhancer repeats and the core COL2A1 promoter. This will allow those repeats to be removed, if desired (by SpeI and NheI digestion). It will also allow an additional set of repeats to be added (i.e., increasing the total to 8) after NheI digestion of the destination vector.