[GFP][IRES][Bla]
(Plasmid #97194)

• Purpose: Vector for our translation quantification assay (Fig. 5). Double reporter vector with internal ribosome entry site.
• Depositing Lab: Edward Boyden
• Publication: Adamala et al Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26.

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: beta-Lactamase
• Alt name: Bla
• Insert Size (bp): 864
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: GTATCTTATCATGTCTGCTCGAAG

Gene/Insert 2

• Gene/Insert name: GFP
• Insert Size (bp): 720

Resource Information

• Supplemental Documents:
  • [GFP][IRES][Bla]

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid as shown in Figure 5B, top, of our paper.