Skip to main content
Addgene

[UBC][NRE Pum][eGFP]
(Plasmid #97192)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97192 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    mutated to remove BsaI, original promoter replaced with UBC promoter
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    wild type Pumilio homology domain
  • Alt name
    WT Pum
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1062
  • Promoter UBC (ubiquitin C)
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer ACTCATCAATGTATCTTATCAT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

"NRE Pum" is the original, wild-type Pum, which binds to the Nanos Response Element (NRE) RNA sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    [UBC][NRE Pum][eGFP] was a gift from Edward Boyden (Addgene plasmid # 97192 ; http://n2t.net/addgene:97192 ; RRID:Addgene_97192)

  • For your References section:

    Programmable RNA-binding protein composed of repeats of a single modular unit. Adamala KP, Martin-Alarcon DA, Boyden ES. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26. 10.1073/pnas.1519368113 PubMed 27118836
Related items:
Commonly requested with: