[UBC][firefly luciferase][target cloning][renilla luciferase]
(Plasmid #97190)

• Purpose: Reporter for translation activation via Pum.
• Depositing Lab: Edward Boyden
• Publication: Adamala et al Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26.

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Modifications to backbone: mutated to remove BsaI, original promoter replaced with UBC promoter
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly Luciferase
• Species: firefly
• Insert Size (bp): 1686
• Promoter: UBC (ubiquitin C)
• Tag / Fusion Protein:
  • none

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: GTATCTTATCATGTCTGCTCGAAG

Gene/Insert 2

• Gene/Insert name: Renilla Luciferase
• Species: sea pansy
• Insert Size (bp): 936

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

"Target cloning" is a HindIII-AscI site for inserting recognition sequences for Pum mediated translation activation of the downstream gene. This plasmid corresponds to that shown in Figure 6A.