-
PurposeExpresses HOXA9 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepINDUCER-21
-
Backbone manufacturerStephen Elledge, Thomas Westbrook
- Backbone size w/o insert (bp) 12152
- Total vector size (bp) 11281
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHOXA9
-
Alt nameHomeobox A9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)816
-
Entrez GeneHOXA9 (a.k.a. ABD-B, HOX1, HOX1.7, HOX1G)
- Promoter Tet on
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer TCTGGGACGTCGTATGGGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER-21-HOXA9 was a gift from George Daley (Addgene plasmid # 97041 ; http://n2t.net/addgene:97041 ; RRID:Addgene_97041) -
For your References section:
Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439