371-U
(Plasmid #97036)

• Purpose: (Empty Backbone) MYFQSNA-yORF
• Depositing Lab: Chris Jeans
• Publication: Series-371: N- or C-terminal Tag E.coli T7 Expression Vectors with Biobrick Polycistronic Restriction Sites and Csy4 cleavage (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 4762
• Vector type: Bacterial Expression
• Promoter: T7
• Tag / Fusion Protein:
  • MYFQSNA (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: T7 Forward
• 3′ sequencing primer: T7 Reverse

Resource Information

• Supplemental Documents:
  • 371-u.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a MYFQSNA fusion tag on the N-terminus

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/.

Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.

In the 371-Series plasmids, upstream of each ribosome binding site is a Csy4 target sequence that allows the polycistronic mRNA to be cleaved upstream of each message when your plasmid is co-expressed with the Csy4 protein. By cleaving the message we hope to avoid detrimental mRNA structures that may result from having a long polycistronic message.