pMGF170
(Plasmid
#96997)
-
Purposeish1-mCherry insertion cassette with NAT resistance gene
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEM GST vector
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 8000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameish1
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)3300
-
Mutationish1 C-terminal domain fused with mCherry + NAT resistance gene
-
Entrez Geneish1 (a.k.a. SPBC365.12c)
- Promoter N/A
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- GST (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTGTTCCTAATTGGGCTGC
- 3′ sequencing primer ctccactaactcgtttccaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMGF170 was a gift from Adam Frost & Wesley Sundquist (Addgene plasmid # 96997 ; http://n2t.net/addgene:96997 ; RRID:Addgene_96997) -
For your References section:
LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, Nikolova L, Bjorkman PJ, Sundquist WI, Ullman KS, Frost A. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27. 10.1073/pnas.1613916114 PubMed 28242692