Skip to main content
Addgene

pMGF130
(Plasmid #96971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 96971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEM GST vector
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 7500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    lem2
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
    2700
  • Mutation
    whole ORF deletion and replaced with hygro resistance gene
  • Entrez Gene
    lem2 (a.k.a. SPAC18G6.10, heh1)
  • Promoter N/A

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGACATCGCTGGAAGCAAC
  • 3′ sequencing primer ATCCATAGTGTCGAACCCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMGF130 was a gift from Adam Frost & Wesley Sundquist (Addgene plasmid # 96971 ; http://n2t.net/addgene:96971 ; RRID:Addgene_96971)
  • For your References section:

    LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, Nikolova L, Bjorkman PJ, Sundquist WI, Ullman KS, Frost A. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27. 10.1073/pnas.1613916114 PubMed 28242692