pTH847-gst-optsc
(Plasmid #96908)

• Purpose: Plasmid for yeast expression of GST encoded by preferred codons
• Depositing Lab: Tobias von der Haar
• Publication: Jossé et al bioRxiv 200006

Backbone

• Vector backbone: pBEVY-U
• Backbone manufacturer: C. A. I. Miller, M. A. Martinat, and L. E. Hyman (1998) Nucleic Acids Res., vol. 26, no. 15, pp. 3577–3583.
• Backbone size w/o insert (bp): 6534
• Total vector size (bp): 7242
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: yeast codon optimised glutathione-S transferase
• Species: synthetic construct
• Insert Size (bp): 694
• GenBank ID: LT856599.1
• Promoter: TDH3
• Tag / Fusion Protein:
  • 8xhistidine (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ctaataagtatataaagaacggtagg
• 3′ sequencing primer: tggaaaagggtcaaatcgttggta

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry