pBItetDMPKSGFP
(Plasmid #96903)

• Purpose: tet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 0 CTG repeats in exon 15 located
• Depositing Lab: Thomas Cooper
• Publication: Lee et al Proc Natl Acad Sci U S A. 2012 Mar 13;109(11):4221-6. doi: 10.1073/pnas.1117019109. Epub 2012 Feb 27.

Backbone

• Vector backbone: pBiTet
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 7100
• Vector type: Mammalian Expression ; tetracycline responsive and bidirectional

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP and human DMPK exons 11-15 with 0 CTG repeats
• Species: H. sapiens (human)
• Insert Size (bp): 4300
• Entrez Gene: DMPK (a.k.a. DM, DM1, DM1PK, DMK, MDPK, MT-PK)
• Promoter: tetracycline responsive and bidirectional

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry