Skip to main content
Addgene

FlagMBNL3
(Plasmid #96901)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 96901 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1 HisC
  • Backbone size w/o insert (bp) 5387
  • Total vector size (bp) 6444
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MBNL3 cDNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1057
  • Entrez Gene
    MBNL3 (a.k.a. CHCR, MBLX, MBLX39, MBXL)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (destroyed during cloning)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATA
  • 3′ sequencing primer CAGAATAGAATGACACCTAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FlagMBNL3 was a gift from Thomas Cooper (Addgene plasmid # 96901 ; http://n2t.net/addgene:96901 ; RRID:Addgene_96901)

  • For your References section:

    A bichromatic fluorescent reporter for cell-based screens of alternative splicing. Orengo JP, Bundman D, Cooper TA. Nucleic Acids Res. 2006;34(22):e148. Epub 2006 Nov 16. 10.1093/nar/gkl967 PubMed 17142220
Related items:
Commonly requested with: