FlagETR3 (CELF2)
(Plasmid #96900)

• Purpose: expression of Flag-tagged human CELF2 (aka CUGBP2)
• Depositing Lab: Thomas Cooper
• Publication: Orengo et al Nucleic Acids Res. 2006;34(22):e148. Epub 2006 Nov 16.

Backbone

• Vector backbone: pcDNA3.1 HisC
• Backbone size w/o insert (bp): 5456
• Total vector size (bp): 6958
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human CELF2 cDNA
• Alt name: ETR3
• Alt name: CUGBP2
• Species: H. sapiens (human)
• Insert Size (bp): 1502
• Entrez Gene: CELF2 (a.k.a. BRUNOL3, CELF-2, CUG-BP2, CUGBP2, DEE97, ETR-3, ETR3, NAPOR)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATA
• 3′ sequencing primer: CAGAATAGAATGACACCTAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry