EKARet-nuc
(Plasmid
#96896)
-
PurposeFLIM sensor for ERK activation in nucleus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLIM Sensor for ERK Activity in Nucleus
-
Alt nameEKARet-nuc
-
Insert Size (bp)2000
- Promoter CMV
-
Tags
/ Fusion Proteins
- sREAChet (N terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CCCTGAACCTGAAACATAAAATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOur lab (EKAR), Michiyuki Matsuda (EKAREV)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Harvey, C.D., Ehrhardt, A.G., Cellurale, C., Zhong, H., Yasuda, R., Davis, R.J., and Svoboda, K. (2008). A genetically encoded fluorescent sensor of ERK activity. Proc. Natl. Acad. Sci. USA 105, 19264–19269.
Komatsu, N., Aoki, K., Yamada, M., Yukinaga, H., Fujita, Y., Kamioka, Y., and Matsuda, M. (2011). Development of an optimized backbone of FRET biosensors for kinases and GTPases. Mol. Biol. Cell 22, 4647–4656.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EKARet-nuc was a gift from Ryohei Yasuda (Addgene plasmid # 96896 ; http://n2t.net/addgene:96896 ; RRID:Addgene_96896) -
For your References section:
Imaging ERK and PKA Activation in Single Dendritic Spines during Structural Plasticity. Tang S, Yasuda R. Neuron. 2017 Mar 22;93(6):1315-1324.e3. doi: 10.1016/j.neuron.2017.02.032. Epub 2017 Mar 9. 10.1016/j.neuron.2017.02.032 PubMed 28285819