EKARet-cyto
(Plasmid #96895)

• Purpose: FLIM sensor for ERK activation in cytosol
• Depositing Lab: Ryohei Yasuda
• Publication: Tang et al Neuron. 2017 Mar 22;93(6):1315-1324.e3. doi: 10.1016/j.neuron.2017.02.032. Epub 2017 Mar 9.

Backbone

• Vector backbone: pCI
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FLIM Sensor for ERK Activity in Cytosol
• Alt name: EKARet-cyto
• Insert Size (bp): 2000
• Promoter: CMV
• Tags / Fusion Proteins:
  • sREAChet (N terminal on insert)
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: CCCTGAACCTGAAACATAAAATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Our lab (EKAR), Michiyuki Matsuda (EKAREV)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Harvey, C.D., Ehrhardt, A.G., Cellurale, C., Zhong, H., Yasuda, R., Davis, R.J., and Svoboda, K. (2008). A genetically encoded fluorescent sensor of ERK activity. Proc. Natl. Acad. Sci. USA 105, 19264–19269.

Komatsu, N., Aoki, K., Yamada, M., Yukinaga, H., Fujita, Y., Kamioka, Y., and Matsuda, M. (2011). Development of an optimized backbone of FRET biosensors for kinases and GTPases. Mol. Biol. Cell 22, 4647–4656.