pWT029h
(Plasmid
#96861)
-
Purpose(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFYF1320
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
-
gRNA/shRNA sequenceGGCATGCTCCCCGTGACCGGTACATCCAGCTGATGAGTCCCAAATAGGACGAGATACTATAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCCGACTAGTGTCCTGGATTCCACGGGCACGGGCAGCTTGCCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWT029h was a gift from David Liu (Addgene plasmid # 96861 ; http://n2t.net/addgene:96861 ; RRID:Addgene_96861) -
For your References section:
Aptazyme-embedded guide RNAs enable ligand-responsive genome editing and transcriptional activation. Tang W, Hu JH, Liu DR. Nat Commun. 2017 Jun 28;8:15939. doi: 10.1038/ncomms15939. 10.1038/ncomms15939 PubMed 28656978