pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1
(Plasmid
#92433)
-
Purposeexpresses Cas9 and gRNA targeting PAFAH1B1
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) v2.0
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePAFAH1B1
-
gRNA/shRNA sequenceCAC CGGCATATTTTTCTGGCGGACG
-
SpeciesH. sapiens (human)
-
Entrez GenePAFAH1B1 (a.k.a. LIS1, LIS2, MDCR, MDS, NudF, PAFAH)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1 was a gift from Ralf Brandes & Matthias Leisegang (Addgene plasmid # 92433 ; http://n2t.net/addgene:92433 ; RRID:Addgene_92433) -
For your References section:
PAFAH1B1 and the lncRNA NONHSAT073641 maintain an angiogenic phenotype in human endothelial cells. Josipovic I, Fork C, Preussner J, Prior KK, Iloska D, Vasconez AE, Labocha S, Angioni C, Thomas D, Ferreiros N, Looso M, Pullamsetti SS, Geisslinger G, Steinhilber D, Brandes RP, Leisegang MS. Acta Physiol (Oxf). 2016 Apr 28. doi: 10.1111/apha.12700. 10.1111/apha.12700 PubMed 27124368