FKBP-Stx4-mCitrine
(Plasmid
#92427)
-
PurposeExpression of syntaxin-4 N-terminally conjugated to FKBP and C-terminally conjugated to mCitrine.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmCitrine-N1
-
Backbone manufacturerVan den Bogaart lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStx4
-
Alt namesyntaxin 4, syntaxin-4
-
SpeciesR. norvegicus (rat)
-
GenBank IDNM_031125.1
-
Entrez GeneStx4 (a.k.a. Stx4a)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCitrine (C terminal on insert)
- FKBP (FK506 binding protein 12); allows for heterodimerization with FRB by rapamycin (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FKBP-Stx4-mCitrine was a gift from Geert van den Bogaart (Addgene plasmid # 92427 ; http://n2t.net/addgene:92427 ; RRID:Addgene_92427) -
For your References section:
Fluorescence lifetime imaging microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation. Verboogen DRJ, Gonzalez Mancha N, Ter Beest M, van den Bogaart G. Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525. 10.7554/eLife.23525 PubMed 28524818