Stx3-mCitrine-mCherry
(Plasmid #92426)

• Purpose: Expression of syntaxin-3 C-terminally conjugated to tandem of mCitrine and mCherry.
• Depositing Lab: Geert van den Bogaart
• Publication: Verboogen et al Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525.

Backbone

• Vector backbone: pmCherry-N1
• Backbone manufacturer: CloneTech
• Modifications to backbone: mCitrine with BamHI restriction sites on both sides was subcloned in the Stx3-mCherry construct
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Stx3
• Alt name: syntaxin 3, syntaxin-3
• Species: R. norvegicus (rat)
• GenBank ID: NM_031124.1
• Entrez Gene: Stx3 (a.k.a. Stx3a)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCitrine (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: CACCTTGAAGCGCATGAACT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry