VAMP8-mCherry
(Plasmid #92424)

• Purpose: Expression of VAMP8 C-terminally conjugated to mCherry.
• Depositing Lab: Geert van den Bogaart
• Publication: Verboogen et al Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525.

Backbone

• Vector backbone: pmCherry-N1
• Backbone manufacturer: CloneTech
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VAMP8
• Alt name: VAMP8,endobrevin
• Species: M. musculus (mouse)
• Mutation: A36S (Please see Depositor Comments below)
• GenBank ID: NM_016794.3
• Entrez Gene: Vamp8 (a.k.a. Edb, endobrevin)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: CACCTTGAAGCGCATGAACT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the VAMP8 sequence is from Uniprot (accession number O70404). Relative to the Genbank sequence (NM_016794.3), this construct carries mutation A36S.