Skip to main content
Addgene

pCAG dCas9-KRAB-2A-EGFP
(Plasmid #92396)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92396 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAGG
  • Backbone size w/o insert (bp) 4951
  • Total vector size (bp) 10183
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9_KRAB_2A_EGFP
  • Insert Size (bp)
    5232
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGCTGGTTATTGTGCTGT
  • 3′ sequencing primer CCAGCCACCACCTTCTGATA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9-KRAB-2A-GFP was amplified from pLV hUbC dCas9 KRAB T2A GFP (Addgene #71237) and cloned into the pCI-H2B-RFP vector linearised with NotI and XhoI.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, Gersbach CA. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. 10.1038/nmeth.3630 PubMed 26501517

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG dCas9-KRAB-2A-EGFP was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92396 ; http://n2t.net/addgene:92396 ; RRID:Addgene_92396)

  • For your References section:

    Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245
Related items:
Commonly requested with: