pcU6_1 sgRNA
(Plasmid #92395)

• Purpose: Chicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: pNG1
• Backbone size w/o insert (bp): 3017
• Total vector size (bp): 3493
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: chick U6.1 promoter and gRNA cloning cassette
• Species: G. gallus (chicken)
• Insert Size (bp): 476
• Promoter: chick U6.1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatcaagcctgattgggagaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: chick U6.1 promoter (Kudo and Sutou, 2005) was cloned into BsaI sites in pNG1 vector #30985-8

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Kudo, T., and S. Sutou. 2005. Usage of putative chicken U6 promoters for vector-based RNA interference. J Reprod Dev. 51:411-417.

Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Apr 14. ():. 10.1093/nar/gkr218 PubMed 21493687

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.