pTK Cas9-2A-Citrine
(Plasmid #92393)

• Purpose: Enhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: pTK
• Backbone size w/o insert (bp): 4157
• Total vector size (bp): 9101
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 2A Citrine
• Species: S. pyogenes
• Insert Size (bp): 4944
• Promoter: thymidine kinase promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctgcggctgatctatctgg
• 3′ sequencing primer: attcacttggggcatgctca

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pTK EGFP was made by Uchikawa et al 2003, by insertion of the Herpes simplex virus thymidine kinase promoter in the polylinker HindIII site of pCAT3-basic vector (Promega), and by replacing the CAT gene with the EGFP gene (Clontech). We have modified this vector by inserting BsmBI flanked lacZ MCS cassette and replaced EGFP with Citrine. Subsequently we amplified Cas9 from #42230 and inserted this followed by a 2A sequence into the NcoI site in the modified pTK citrine vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718

Functional analysis of chicken Sox2 enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Uchikawa M1, Ishida Y, Takemoto T, Kamachi Y, Kondoh H. Dev Cell. 2003 Apr;4(4):509-19.

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.