Skip to main content
Addgene

pX330a dCas9-VP64
(Plasmid #92363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    x330
  • Backbone size w/o insert (bp) 4252
  • Total vector size (bp) 8596
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-VP64
  • Insert Size (bp)
    4344
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tctgactgaccgcgttactc
  • 3′ sequencing primer aggaaaggacagtgggagtg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas9m4-VP64 was amplified from (Addgene #47319) and cloned into pX330 (Addgene #42230).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. 10.1038/nbt.2675 PubMed 23907171

Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330a dCas9-VP64 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92363 ; http://n2t.net/addgene:92363 ; RRID:Addgene_92363)
  • For your References section:

    Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245