pX330a dCas9-LSD1
(Plasmid #92362)

• Purpose: Modified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to LSD1. For targeted enhancer demethylation in chicken embryos.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: x330
• Backbone size w/o insert (bp): 4237
• Total vector size (bp): 10984
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-LSD1
• Insert Size (bp): 6747
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tctgactgaccgcgttactc
• 3′ sequencing primer: AGGAAAGGACAGTGGGAGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cas9m4-VP64 was amplified from (Addgene #47319) and cloned into pX330 (Addgene #42230). VP64 was then removed by EcoRI digest and LSD1 was inserted from EMM67 (Addgene #49043)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. 10.1038/nbt.2675 PubMed 23907171

Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718

Locus-specific editing of histone modifications at endogenous enhancers. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE. Nat Biotechnol. 2013 Sep 8. doi: 10.1038/nbt.2701. 10.1038/nbt.2701 PubMed 24013198

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.