pX330a dCas9-KRAB
(Plasmid #92361)

• Purpose: Modified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to KRAB repressor domain. For targeted enhancer inactivation in chicken embryos.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: x330
• Backbone size w/o insert (bp): 4332
• Total vector size (bp): 8731
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-KRAB
• Insert Size (bp): 4399
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tctgactgaccgcgttactc
• 3′ sequencing primer: aggaaaggacagtgggagtg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cas9m4-VP64 was amplified from (Addgene #47319) and cloned into pX330 (Addgene #42230). VP64 was then removed by EcoRI digest and KRAB was inserted by In-fusion of a synthetic gBlock containing the KRAB sequence into the EcoRI-linearised pX330 vector.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. 10.1038/nbt.2675 PubMed 23907171

Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718

Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, Gersbach CA. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. 10.1038/nmeth.3630 PubMed 26501517

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.