pJB153
(Plasmid #92328)

• Purpose: Express mEos3.2 tagged ZapA in E coli
• Depositing Lab: Jie Xiao
• Publication: Lyu et al Biopolymers. 2016 Oct;105(10):725-34. doi: 10.1002/bip.22895.

Backbone

• Vector backbone: pCA24N
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Note the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZapA
• Species: E. coli
• Insert Size (bp): 327
• Promoter: T5-lac
• Tag / Fusion Protein:
  • mEos3.2 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ctttcgtcttcacctcgagaaatc
• 3′ sequencing primer: gctaattaagcttggctgcaggt

Resource Information

• Supplemental Documents:
  • pJB153.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry