WT1 KI gRNA1
(Plasmid
#92312)
-
PurposeCRISPR-GFP-gRNA for cutting WT1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92312 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCRISPR-eGFP
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9292
-
Modifications to backbonegRNA1 targeting WT1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWT1
-
Alt nameAWT1
-
gRNA/shRNA sequenceAACTCCAGCTGGCGCTTTGAG (gRNA shown is without PAM sequence)
-
SpeciesH. sapiens (human)
-
GenBank ID7490
-
Entrez GeneWT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
-
Tag
/ Fusion Protein
- CRISPR GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BBSI (destroyed during cloning)
- 3′ cloning site BBSI (destroyed during cloning)
- 5′ sequencing primer tttcttgggtagtttgcagtttt
- 3′ sequencing primer CGGGTACCTCTAGAGCCATTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WT1 KI gRNA1 was a gift from Sean Palecek (Addgene plasmid # 92312 ; http://n2t.net/addgene:92312 ; RRID:Addgene_92312) -
For your References section:
Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Bao X, Lian X, Hacker TA, Schmuck EG, Qian T, Bhute VJ, Han T, Shi M, Drowley L, Plowright A, Wang QD, Goumans MJ, Palecek SP. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5. 10.1038/s41551-016-0003 PubMed 28462012