Skip to main content
Addgene

VE-cad KI gRNA2
(Plasmid #92311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92311 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CRISPR-GFP
  • Backbone size w/o insert (bp) 9289
  • Total vector size (bp) 9292
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VEcad KI gRNA2
  • Alt name
    CDH5
  • gRNA/shRNA sequence
    TTTTTGGAGGCTGTGGTGCC (gRNA shown is without PAM sequence)
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    CDH5 (a.k.a. 7B4, CD144)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BBSI (destroyed during cloning)
  • 3′ cloning site BBSI (destroyed during cloning)
  • 5′ sequencing primer tttcttgggtagtttgcagtttt
  • 3′ sequencing primer CGGGTACCTCTAGAGCCATTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VE-cad KI gRNA2 was a gift from Sean Palecek (Addgene plasmid # 92311 ; http://n2t.net/addgene:92311 ; RRID:Addgene_92311)
  • For your References section:

    Human pluripotent stem cell-derived epicardial progenitors can differentiate to endocardial-like endothelial cells. Bao X, Bhute VJ, Han T, Qian T, Lian X, Palecek SP. Bioeng Transl Med. 2017 Jun;2(2):191-201. doi: 10.1002/btm2.10062. Epub 2017 May 22. 10.1002/btm2.10062 PubMed 29170757