Skip to main content
Addgene

pZac2.1 GfaABC1D hM3D mCherry SV40
(Plasmid #92284)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92284 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pZac2.1
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hM3D
  • Species
    H. sapiens (human)
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer AAGCTTCTTGTACAGCTCGTCCATGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 GfaABC1D hM3D mCherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 92284 ; http://n2t.net/addgene:92284 ; RRID:Addgene_92284)
  • For your References section:

    Neural Circuit-Specialized Astrocytes: Transcriptomic, Proteomic, Morphological, and Functional Evidence. Chai H, Diaz-Castro B, Shigetomi E, Monte E, Octeau JC, Yu X, Cohn W, Rajendran PS, Vondriska TM, Whitelegge JP, Coppola G, Khakh BS. Neuron. 2017 Aug 2;95(3):531-549.e9. doi: 10.1016/j.neuron.2017.06.029. Epub 2017 Jul 14. 10.1016/j.neuron.2017.06.029 PubMed 28712653