-
PurposeAAV DREADD expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZac2.1
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehM3D
-
SpeciesH. sapiens (human)
-
Entrez GeneCHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
- Promoter GfaABC1D
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer AAGCTTCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 GfaABC1D hM3D mCherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 92284 ; http://n2t.net/addgene:92284 ; RRID:Addgene_92284) -
For your References section:
Neural Circuit-Specialized Astrocytes: Transcriptomic, Proteomic, Morphological, and Functional Evidence. Chai H, Diaz-Castro B, Shigetomi E, Monte E, Octeau JC, Yu X, Cohn W, Rajendran PS, Vondriska TM, Whitelegge JP, Coppola G, Khakh BS. Neuron. 2017 Aug 2;95(3):531-549.e9. doi: 10.1016/j.neuron.2017.06.029. Epub 2017 Jul 14. 10.1016/j.neuron.2017.06.029 PubMed 28712653