pZac2.1 hSynapsin1 FLEX NAPA-N SV40
(Plasmid #92283)

• Purpose: FRET probe; extracellular synapse targeted mCherry, Cre-dependently expressed
• Depositing Lab: Baljit Khakh
• Publication: Octeau et al Neuron. 2018 Apr 4;98(1):49-66.e9. doi: 10.1016/j.neuron.2018.03.003.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pZac2.1
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Neuron-astrocyte proximity assay - Neuronal
• Alt name: NAPA-N
• Species: Synthetic
• Insert Size (bp): 1653
• Promoter: hSynapsin1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACCATCTGCGCTGCGGCG
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATCAAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry