-
PurposeFRET probe; extracellular membrane tethered eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZac2.1
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeuron-astrocyte proximity assay - Astrocyte
-
Alt nameNAPA-A
-
SpeciesSynthetic
-
Insert Size (bp)966
- Promoter GfaABC1D
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGCTTCTTGTACAGCTCGTCCATGCC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCAAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 GfaABC1D NAPA-A SV40 was a gift from Baljit Khakh (Addgene plasmid # 92281 ; http://n2t.net/addgene:92281 ; RRID:Addgene_92281) -
For your References section:
An Optical Neuron-Astrocyte Proximity Assay at Synaptic Distance Scales. Octeau JC, Chai H, Jiang R, Bonanno SL, Martin KC, Khakh BS. Neuron. 2018 Apr 4;98(1):49-66.e9. doi: 10.1016/j.neuron.2018.03.003. 10.1016/j.neuron.2018.03.003 PubMed 29621490