pMCh-607
(Plasmid
#92258)
-
PurposePlasmid for expression of NHA-tagged human TNRC6C CED 7W7A with seven mutated W-motifs in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCiNeo-NHA
- Backbone size w/o insert (bp) 5622
- Total vector size (bp) 6591
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNRC6C CED
-
SpeciesH. sapiens (human)
-
Insert Size (bp)969
-
MutationC-terminal effector domain (CED): aa 1369-1690 with the following point mutations: W1445A; W1487A;W1494A; W1504A; W1605A; W1648A; W1659A
-
GenBank IDNM_001142640.1
-
Entrez GeneTNRC6C
- Promoter CMV
-
Tag
/ Fusion Protein
- NHA (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer ACTGCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh-607 was a gift from Marina Chekulaeva & Witold Filipowicz (Addgene plasmid # 92258 ; http://n2t.net/addgene:92258 ; RRID:Addgene_92258) -
For your References section:
miRNA repression involves GW182-mediated recruitment of CCR4-NOT through conserved W-containing motifs. Chekulaeva M, Mathys H, Zipprich JT, Attig J, Colic M, Parker R, Filipowicz W. Nat Struct Mol Biol. 2011 Oct 7;18(11):1218-26. doi: 10.1038/nsmb.2166. 10.1038/nsmb.2166 PubMed 21984184