Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCh-658
(Plasmid #92257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92257 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCiNeo-NHA
  • Backbone size w/o insert (bp) 5622
  • Total vector size (bp) 6591
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TNRC6C CED
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    969
  • Mutation
    C-terminal effector domain (CED): aa 1369-1690 with the following point mutations: EF1388AA.
  • GenBank ID
    NM_001142640.1
  • Entrez Gene
    TNRC6C
  • Promoter CMV
  • Tag / Fusion Protein
    • NHA (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer ACTGCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCh-658 was a gift from Marina Chekulaeva & Witold Filipowicz (Addgene plasmid # 92257 ; http://n2t.net/addgene:92257 ; RRID:Addgene_92257)
  • For your References section:

    miRNA repression involves GW182-mediated recruitment of CCR4-NOT through conserved W-containing motifs. Chekulaeva M, Mathys H, Zipprich JT, Attig J, Colic M, Parker R, Filipowicz W. Nat Struct Mol Biol. 2011 Oct 7;18(11):1218-26. doi: 10.1038/nsmb.2166. 10.1038/nsmb.2166 PubMed 21984184