pJOP-HTT-HR45Q
(Plasmid
#92248)
-
PurposeHTT donor DNA with 45Q for homologous recombination-mediated gene modification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePBHR100A-1 (SBI)
- Backbone size w/o insert (bp) 7925
-
Vector typePrecisionX HR targeting vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHTT donor DNA
-
SpeciesH. sapiens (human)
-
MutationBarcode of wobble bases to prevent TALEN cleaving donor DNA: CAA CTG CCA CAC CCG CC
-
Entrez GeneHTT (a.k.a. HD, IT15, LOMARS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI/NotI (not destroyed)
- 3′ cloning site BspQI (destroyed)/SpeI (destroyed during cloning)
- 5′ sequencing primer GTTTCGCCACCTCTGACTTG (-588)
- 3′ sequencing primer TCATTTTGACTCACGCGGTC (-196) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJOP-HTT-HR45Q was a gift from Mahmoud Pouladi (Addgene plasmid # 92248 ; http://n2t.net/addgene:92248 ; RRID:Addgene_92248) -
For your References section:
Unbiased Profiling of Isogenic Huntington Disease hPSC-Derived CNS and Peripheral Cells Reveals Strong Cell-Type Specificity of CAG Length Effects. Ooi J, Langley SR, Xu X, Utami KH, Sim B, Huang Y, Harmston NP, Tay YL, Ziaei A, Zeng R, Low D, Aminkeng F, Sobota RM, Ginhoux F, Petretto E, Pouladi MA. Cell Rep. 2019 Feb 26;26(9):2494-2508.e7. doi: 10.1016/j.celrep.2019.02.008. 10.1016/j.celrep.2019.02.008 PubMed 30811996