pJExpress414_GmPOPB
(Plasmid #92234)

• Purpose: Express wild type prolyl oligopeptidase from Galerina marginata
• Depositing Lab: James Naismith
• Publication: Czekster et al Biochemistry. 2017 Apr 18;56(15):2086-2095. doi: 10.1021/acs.biochem.7b00012. Epub 2017 Apr 7.

Backbone

• Vector backbone: pJ414
• Backbone manufacturer: DNA 2.0
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6229
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Prolyl oligopeptidase B from Galerina marginata
• Alt name: GmPOPB
• Species: Galerina marginata
• Insert Size (bp): 2235
• Mutation: none
• GenBank ID: JN827314.2
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • 6x-Histag, TEV cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TTAATACGACTCACTATAGG
• 3′ sequencing primer: AAACCCCTCAAGACC

Resource Information

• Supplemental Documents:
  • GmPOPB fasta all plasmid pJ414_Genbank.gb
• A portion of this plasmid was derived from a plasmid made by: DNA 2.0

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry