Skip to main content
Addgene

pBEST-p70a-UTR1-deGFP Y35TAG D193TAG-6xHis-T500
(Plasmid #92227)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92227 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBEST
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2530
  • Total vector size (bp) 3232
  • Vector type
    Bacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    deGFP Y35TAG D193TAG
  • Alt name
    eGFP-Del6-229 Y35TAG D193TAG
  • Species
    Synthetic
  • Insert Size (bp)
    702
  • Mutation
    Residues Y35 D193 were mutated into TAG (Amber) stop codon for ncAA incorporation
  • Promoter p70a
  • Tag / Fusion Protein
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTGAAGACTATCGCACCATCAG
  • 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional reference:

Shin, J., and Noireaux, V. (2010) Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70. J. Biol. Eng. 4, 8.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-p70a-UTR1-deGFP Y35TAG D193TAG-6xHis-T500 was a gift from Lital Alfonta (Addgene plasmid # 92227 ; http://n2t.net/addgene:92227 ; RRID:Addgene_92227)

  • For your References section:

    Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids. Schlesinger O, Chemla Y, Heltberg M, Ozer E, Marshall R, Noireaux V, Jensen MH, Alfonta L. ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019. 10.1021/acssynbio.7b00019 PubMed 28230975
Related items: