pBEST-p70b-UTR1-deGFP-6xHis-T500
(Plasmid #92222)

• Purpose: Expression of deGFP using the p70b promoter (weak version of the p70a promoter)
• Depositing Lab: Lital Alfonta
• Publication: Schlesinger et al ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019.

Backbone

• Vector backbone: pBEST
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2530
• Total vector size (bp): 3232
• Vector type: Bacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: deGFP
• Alt name: eGFP-Del6-229
• Species: Synthetic
• Insert Size (bp): 702
• Promoter: p70b (p70a promoter with one mutation)
• Tag / Fusion Protein:
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GTGAAGACTATCGCACCATCAG
• 3′ sequencing primer: GATAAAGAAGACAGTCATAAGTGC

Resource Information

• Supplemental Documents:
  • pBEST-p70b-UTR1-GFP-His-T500.gb
• A portion of this plasmid was derived from a plasmid made by: Vincent Noireaux

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional reference:

Shin, J., and Noireaux, V. (2010) Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70. J. Biol. Eng. 4, 8.