pLenti_dCas9-2xAM_hIRF-1
(Plasmid #92221)

• Purpose: Lentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoter
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4.

Backbone

• Vector backbone: CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
• Backbone manufacturer: Yoichi Sekita
• Backbone size w/o insert (bp): 9921
• Total vector size (bp): 14156
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Sp-dCas9-2xAM tag
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4233
• Mutation: human codon-optimized, D10A + H840A
• Promoter: CBh
• Tag / Fusion Protein:
  • 2xAM tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age I (not destroyed)
• 3′ cloning site: BamH I (not destroyed)
• 5′ sequencing primer: TGGCAGTATTCATCCACAATTT
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGC

Gene/Insert 2

• Gene/Insert name: gRNA targeting human IRF-1 promoter
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bbs I (destroyed during cloning)
• 3′ cloning site: Bbs I (destroyed during cloning)
• 5′ sequencing primer: gagggcctatttcccatgat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry