Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti_dCas9-2xAM
(Plasmid #92220)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92220 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
  • Backbone manufacturer
    Yoichi Sekita
  • Backbone size w/o insert (bp) 9921
  • Total vector size (bp) 14154
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Sp-dCas9-2xAM tag
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4233
  • Mutation
    human codon-optimized, D10A + H840A
  • Promoter CBh
  • Tag / Fusion Protein
    • 2xAM tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age I (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer TGGCAGTATTCATCCACAATTT
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA to be inserted into Bbs I sites
  • Species
    Synthetic
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs I (not destroyed)
  • 3′ cloning site Bbs I (not destroyed)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA can be cloned into Bbs I sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_dCas9-2xAM was a gift from Hodaka Fujii (Addgene plasmid # 92220 ; http://n2t.net/addgene:92220 ; RRID:Addgene_92220)
  • For your References section:

    enChIP systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4. 10.1186/s13104-018-3262-4 PubMed 29482606