Skip to main content
Addgene

Ca-FLARE (TF)
(Plasmid #92213)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92213 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV vector
  • Backbone size w/o insert (bp) 3659
  • Total vector size (bp) 6374
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NRX-TM-Nav1.6 -CaMbp(M2)-eLOV-TEVcs(ENLYFQ▲M)-tTA-VP16
  • Species
    Synthetic
  • Insert Size (bp)
    2715
  • Promoter synapsin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGACCATCTGCGCTGCGGCGCC
  • 3′ sequencing primer GGCGCGCCagcgctgctcgag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ca-FLARE (TF) was a gift from Alice Ting (Addgene plasmid # 92213 ; http://n2t.net/addgene:92213 ; RRID:Addgene_92213)

  • For your References section:

    A light- and calcium-gated transcription factor for imaging and manipulating activated neurons. Wang W, Wildes CP, Pattarabanjird T, Sanchez MI, Glober GF, Matthews GA, Tye KM, Ting AY. Nat Biotechnol. 2017 Jun 26. doi: 10.1038/nbt.3909. 10.1038/nbt.3909 PubMed 28650461
Related items:
Commonly requested with: