MolBC
(Plasmid
#92210)
-
PurposeExpression of H. influenzae MolBC (ABC Transporter) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET21b(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6763
-
Modifications to backboneAdded the entire expression section of pET19b + MolC into pET21b(+) vector
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMolC
-
Alt nameH. influenzae ABC Transporter
-
Alt nameHI1471
-
Entrez GeneHI1471 (a.k.a. HI1471)
- Promoter T7 Promoter
-
Tags
/ Fusion Proteins
- 8x Histidine Tag (N terminal on insert)
- Enterokinase Cleavage Site between Histidine Tag and MolB (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gccgttgagcaccgccgccgcaaggaatgg
- 3′ sequencing primer cacgatatccaatacggaata (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMolB
-
Alt nameH. influenzae ABC Transporter
-
Alt nameHI1470
-
Entrez GeneHI1470 (a.k.a. HI1470)
- Promoter T7 Promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer tggttgatggggagttttgc
- 3′ sequencing primer T7 Terminator (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MolBC was a gift from Douglas Rees (Addgene plasmid # 92210 ; http://n2t.net/addgene:92210 ; RRID:Addgene_92210) -
For your References section:
An inward-facing conformation of a putative metal-chelate-type ABC transporter. Pinkett HW, Lee AT, Lum P, Locher KP, Rees DC. Science. 2007 Jan 19;315(5810):373-7. Epub 2006 Dec 7. 10.1126/science.1133488 PubMed 17158291