BtuCD
(Plasmid #92208)

• Purpose: Expression of BtuCD in E. coli
• Depositing Lab: Douglas Rees
• Publication: Locher et al Science. 2002 May 10;296(5570):1091-8.

Backbone

• Vector backbone: pET21b+
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5221
• Total vector size (bp): 6946
• Modifications to backbone: Added entire expression section of pET19b with BtuC gene into original pET21b+. There are 2 expression regions for BtuC and BtuD each with their own T7 Promoter and Terminator
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: btuC
• Insert Size (bp): 978
• GenBank ID:
• Entrez Gene: btuC (a.k.a. b1711, ECK1709, JW1701)
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • 10x Histidine Tag (N terminal on insert)
  • Enterokinase Cleavage Site (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gccgttgagcaccgccgccgcaaggaatgg
• 3′ sequencing primer: tactggatgatgggcggtttt AND ctaACGTCCTGCTTTTAACAATAACCAG

Gene/Insert 2

• Gene/Insert name: btuD
• Insert Size (bp): 747
• GenBank ID:
• Entrez Gene: btuD (a.k.a. b1709, ECK1707, JW1699)
• Promoter: T7 Promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: CTGCCGCAGAGCTGCCTATTG
• 3′ sequencing primer: CCGCGCTTAATGCGCCGCTACAGGGCGCGT

Resource Information

• Supplemental Documents:
  • cj-e-coli-btuc-e-coli-btud.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry