Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BtuCD
(Plasmid #92208)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92208 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET21b+
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5221
  • Total vector size (bp) 6946
  • Modifications to backbone
    Added entire expression section of pET19b with BtuC gene into original pET21b+. There are 2 expression regions for BtuC and BtuD each with their own T7 Promoter and Terminator
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    btuC
  • Insert Size (bp)
    978
  • GenBank ID
  • Entrez Gene
    btuC (a.k.a. b1711, ECK1709, JW1701)
  • Promoter T7 Promoter
  • Tags / Fusion Proteins
    • 10x Histidine Tag (N terminal on insert)
    • Enterokinase Cleavage Site (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gccgttgagcaccgccgccgcaaggaatgg
  • 3′ sequencing primer tactggatgatgggcggtttt AND ctaACGTCCTGCTTTTAACAATAACCAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    btuD
  • Insert Size (bp)
    747
  • GenBank ID
  • Entrez Gene
    btuD (a.k.a. b1709, ECK1707, JW1699)
  • Promoter T7 Promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CTGCCGCAGAGCTGCCTATTG
  • 3′ sequencing primer CCGCGCTTAATGCGCCGCTACAGGGCGCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BtuCD was a gift from Douglas Rees (Addgene plasmid # 92208 ; http://n2t.net/addgene:92208 ; RRID:Addgene_92208)
  • For your References section:

    The E. coli BtuCD structure: a framework for ABC transporter architecture and mechanism. Locher KP, Lee AT, Rees DC. Science. 2002 May 10;296(5570):1091-8. 10.1126/science.1071142 PubMed 12004122