-
PurposeFluorescent protein reporter construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV vector
- Backbone size w/o insert (bp) 4037
- Total vector size (bp) 5119
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)738
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcggccgcACGCGTccttc
- 3′ sequencing primer CATAGTTAAGAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-mCherry was a gift from Alice Ting (Addgene plasmid # 92202 ; http://n2t.net/addgene:92202 ; RRID:Addgene_92202) -
For your References section:
A light- and calcium-gated transcription factor for imaging and manipulating activated neurons. Wang W, Wildes CP, Pattarabanjird T, Sanchez MI, Glober GF, Matthews GA, Tye KM, Ting AY. Nat Biotechnol. 2017 Jun 26. doi: 10.1038/nbt.3909. 10.1038/nbt.3909 PubMed 28650461