Skip to main content
Addgene

pLenti-DsRed_IRES_MAPT:EGFP
(Plasmid #92196)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92196 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-GPS-GAW-IRES
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 11415
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DsRed-IRES-MAPT-EGFP
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    3368

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer IRES-F: GCCCCCCGAACCACGGGGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-DsRed_IRES_MAPT:EGFP was a gift from Huda Zoghbi (Addgene plasmid # 92196 ; http://n2t.net/addgene:92196 ; RRID:Addgene_92196)
  • For your References section:

    TRIM28 regulates the nuclear accumulation and toxicity of both alpha-synuclein and tau. Rousseaux MW, de Haro M, Lasagna-Reeves CA, De Maio A, Park J, Jafar-Nejad P, Al-Ramahi I, Sharma A, See L, Lu N, Vilanova-Velez L, Klisch TJ, Westbrook TF, Troncoso JC, Botas J, Zoghbi HY. Elife. 2016 Oct 25;5. pii: e19809. doi: 10.7554/eLife.19809. 10.7554/eLife.19809 PubMed 27779468