Skip to main content
Addgene

pTEF:ATP
(Plasmid #92179)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92179 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    HO-poly-KanMX4-HO
  • Backbone manufacturer
    Voth et al. (2001) Nucleic Acids Res (PMID: 11410682)
  • Backbone size w/o insert (bp) 6062
  • Total vector size (bp) 6038
  • Modifications to backbone
    The entire backbone was used except for the poly region. Because we used Gibson DNA assembly to construct the plasmid we did not need restriction sites and the poly region.
  • Vector type
    Yeast Expression ; Integration and expression into yeast.
  • Selectable markers
    G418 (Geneticin)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
  • Alt name
    ATP FRET sensor
  • Species
    Synthetic
  • Insert Size (bp)
    1836
  • GenBank ID
  • Promoter TEF1p
  • Tag / Fusion Protein
    • Yeast codon optimized mseCFP (donor) and cp173-mVenus (acceptor) are parts of the ATeam1.03 FRET sensor.

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGTATTGTGTCATGTTCG
  • 3′ sequencing primer GACAGTCACATCATGCC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original version of the ATeam1.03 FRET sensor (tested in mammalian cells but not codon optimized for yeast) was published in 2009 by Imamura et al (PMID: 19720993)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTEF:ATP was a gift from Matthias Heinemann (Addgene plasmid # 92179 ; http://n2t.net/addgene:92179 ; RRID:Addgene_92179)

  • For your References section:

    Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441
Related items:
Commonly requested with: