CMV-sgE1TSS-short-3'box
(Plasmid
#92165)
-
PurposesgRNA expression vector for Evx1as RNA tethering assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEvx1as short isoform
-
gRNA/shRNA sequencegttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)621
- Promoter CMV
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-sgE1TSS-short-3'box was a gift from Xiaohua Shen (Addgene plasmid # 92165 ; http://n2t.net/addgene:92165 ; RRID:Addgene_92165) -
For your References section:
Divergent lncRNAs Regulate Gene Expression and Lineage Differentiation in Pluripotent Cells. Luo S, Lu JY, Liu L, Yin Y, Chen C, Han X, Wu B, Xu R, Liu W, Yan P, Shao W, Lu Z, Li H, Na J, Tang F, Wang J, Zhang YE, Shen X. Cell Stem Cell. 2016 May 5;18(5):637-52. doi: 10.1016/j.stem.2016.01.024. Epub 2016 Mar 17. 10.1016/j.stem.2016.01.024 PubMed 26996597